Reagents manufactured from these sequences may not be used for diagnostic testing under FDA’s authorization of the CDC 2019-nCoV Real-Time RT-PCR Diagnostic Panel. Only primers and probes labeled for EUA use and distributed by the International Reagent Resource may be used for diagnostic testing with the CDC 2019-nCoV Real-Time RT-PCR

Note that the index read primer is complementary to the Read 2 sequencing primer (see diagram below). This is used to sequence the hexamer index tag in the forward direction after read 1 is complete, before the reverse strand is synthesised by bridge amplification. Note that the index read primer is complementary to the Read 2 sequencing primer (see diagram below). This is used to sequence the hexamer index tag in the forward direction after read 1 is complete, before the reverse strand is synthesised by bridge amplification. It involves 96 unique Index 1 (i7) adapters and 96 unique Index 2 (i5) adapters, preventing repeated sequences in a well plate. Along with other best practices, the unique dual indexing strategy will help make sure that your libraries will demultiplex with high accuracy across all Illumina sequencing platforms. However, in some cases, primer-blast cannot determine if a database sequence is an intended target or not, thus the user guidance might be helpful (For example, when your template is a polymorphic form or a partial region of an entry in the search database, or when the database such as the nr contains redundant entries of your template). M13 forward sequencing primer (-20): GTAAAACGACGGCCAGT M13 forward sequencing primer (-40): GTTTTCCCAGTCACGAC M13 forward sequencing primer (-47): CGCCAGGGTTTTCCCAGTCACGAC

The Swift RNA Library Kit leverages an Indexing PCR step to complete the fully indexed adapter sequences, using primers that anneal to the truncated adapters  

Illumina reserves all rights in the oligonucleotides and their sequence Nextera Index Kit – PCR Primers . Multiplexing Index Read Sequencing Primer . 1 Oct 2018 Their manufacture, use, and sequence information are protected by Nextera Index Kit – PCR Primers . Genomic DNA Sequencing Primer . When setting up the sequencing run, select “Dual Index” and choose the indices used for each sample. Option 2: 3 (i7) * 4 (i5). From the i7 primers, choose a valid   For the HiSeq, the Index 2 sequencing primer is part of HP14, an indexing primer mix that contains primers for both index reads. Figure 2 Dual-Indexed  During this step, sequences for primer binding, indices, and terminal sequences are added. Indices are usually six base pairs long and are used during DNA  21 Jun 2013 In the first PCR step, the two primers used contain an Illumina sequencing primer, an index (i.e., barcode) sequence, and the gene-specific 

As a young and dynamic company, specialized in life sciences applications for R&D and diagnostics, we are dedicated to deliver premium quality products for 

During this step, sequences for primer binding, indices, and terminal sequences are added. Indices are usually six base pairs long and are used during DNA  21 Jun 2013 In the first PCR step, the two primers used contain an Illumina sequencing primer, an index (i.e., barcode) sequence, and the gene-specific 

Amplify and tag DNA-seq libraries with SMARTer DNA index PCR primers with all of our DNA-seq kits to generate libraries for use in multiplexed sequencing 

M13 forward sequencing primer (-20): GTAAAACGACGGCCAGT M13 forward sequencing primer (-40): GTTTTCCCAGTCACGAC M13 forward sequencing primer (-47): CGCCAGGGTTTTCCCAGTCACGAC

rhAmpSeq Index Primers Combine amplicon libraries in a single sequencing run for maximum efficiency Use rhAmpSeq Index Primers to prepare amplicon libraries for targeted sequencing on Illumina platforms by adding a unique, identifying “barcode” sequence to each amplicon.

The unique hairpin loop structure of the NEBNext Adaptor minimizes adaptor-dimer formation, and NEBNext index PCR primers enable index incorporation during library amplification. Additional NEBNext Multiplex Oligos products are available with sets of 12 and 96 single index primers as well as dual index primers. Note that the index read primer is complementary to the Read 2 sequencing primer (see diagram below). This is used to sequence the hexamer index tag in the forward direction after read 1 is complete, before the reverse strand is synthesised by bridge amplification. Note that the index read primer is complementary to the Read 2 sequencing primer (see diagram below). This is used to sequence the hexamer index tag in the forward direction after read 1 is complete, before the reverse strand is synthesised by bridge amplification. It involves 96 unique Index 1 (i7) adapters and 96 unique Index 2 (i5) adapters, preventing repeated sequences in a well plate. Along with other best practices, the unique dual indexing strategy will help make sure that your libraries will demultiplex with high accuracy across all Illumina sequencing platforms. However, in some cases, primer-blast cannot determine if a database sequence is an intended target or not, thus the user guidance might be helpful (For example, when your template is a polymorphic form or a partial region of an entry in the search database, or when the database such as the nr contains redundant entries of your template).

When setting up the sequencing run, select “Dual Index” and choose the indices used for each sample. Option 2: 3 (i7) * 4 (i5). From the i7 primers, choose a valid   For the HiSeq, the Index 2 sequencing primer is part of HP14, an indexing primer mix that contains primers for both index reads. Figure 2 Dual-Indexed  During this step, sequences for primer binding, indices, and terminal sequences are added. Indices are usually six base pairs long and are used during DNA  21 Jun 2013 In the first PCR step, the two primers used contain an Illumina sequencing primer, an index (i.e., barcode) sequence, and the gene-specific